q24 pyrosequencer (Qiagen)
Qiagen is a verified supplier 
Qiagen manufactures this product 
90
Structured Review
Qiagen
q24 pyrosequencer
Q24 Pyrosequencer, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/q24+pyrosequencer/q24+pyrosequencer/pmc10804026__jcp___2022___208462supp001-30-24-24
Average 90 stars, based on 1 article reviews
Q24 Pyrosequencer, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/q24+pyrosequencer/q24+pyrosequencer/pmc10804026__jcp___2022___208462supp001-30-24-24
Average 90 stars, based on 1 article reviews
q24 pyrosequencer - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Sequencing:Article Title: Article Snippet: .. For MGMT, a nested sequencing primer 52 (GTTTTTAGAACGTTTTGYGTTT) was used to analyse 4 CpGs in 10 μl of the PCR sample on the 53 Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high fat diet Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high-fat diet. Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4–8 (F–TTT AGT AGA GGA AAT AAA ATA GTA GAA AAA -Biotinylated; R: CCC CAA AAA ACC ACA AAA CCTA) CpGs 9–11 (F – GGA TGG AGG AAT TTT TTT GTGTT; R: CCC CAA AAA ACC ACA AAA CCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high-fat diet Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4–8 (F–TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9–11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Polymerase Chain Reaction:Article Title: Article Snippet: .. For MGMT, a nested sequencing primer 52 (GTTTTTAGAACGTTTTGYGTTT) was used to analyse 4 CpGs in 10 μl of the PCR sample on the 53 Article Title: Frequency of natural regulatory T cells specific for factor VIII in the peripheral blood of healthy donors. Article Snippet: Genomic DNA was isolated using the QIAamp DNA Micro or Mini Kit (QIAGEN) depending on cell numbers and bisulfite-treated with the EpiTect Fast 96 DNA Bisulfite Kit (QIAGEN) according to the manufacturer’s instructions. .. The FOXP3 TSDR region was amplified by PCR (forward primer: 5’-TGGGTTAAGTTTGTTGTAGGATAGG; reverse primer: 5’-BiotinTCCCTTTCTAACTAAATTTCTCAAAAAC) in the bisulfite-treated samples and analyzed on a Control:Article Title: Regulation of interleukin 6 by a polymorphic CpG within the frontal cortex in Alzheimer's disease. Article Snippet: Amplicons were processed on the Qiagen Q24 Workstation and sequenced using the Sequencing primer AAACCTTATTAAAATTATACAATAT designed to analyze the region AACRTCCTTTAACATAACAA AACACAACTAAAAAAAAAAAT. .. Assays were performed in duplicate on the Amplification:Article Title: Frequency of natural regulatory T cells specific for factor VIII in the peripheral blood of healthy donors. Article Snippet: Genomic DNA was isolated using the QIAamp DNA Micro or Mini Kit (QIAGEN) depending on cell numbers and bisulfite-treated with the EpiTect Fast 96 DNA Bisulfite Kit (QIAGEN) according to the manufacturer’s instructions. .. The FOXP3 TSDR region was amplified by PCR (forward primer: 5’-TGGGTTAAGTTTGTTGTAGGATAGG; reverse primer: 5’-BiotinTCCCTTTCTAACTAAATTTCTCAAAAAC) in the bisulfite-treated samples and analyzed on a DNA Methylation Assay:Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high fat diet Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high-fat diet. Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4–8 (F–TTT AGT AGA GGA AAT AAA ATA GTA GAA AAA -Biotinylated; R: CCC CAA AAA ACC ACA AAA CCTA) CpGs 9–11 (F – GGA TGG AGG AAT TTT TTT GTGTT; R: CCC CAA AAA ACC ACA AAA CCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Article Title: The anxiety and ethanol intake controlling GAL5.1 enhancer is epigenetically modulated by, and controls preference for, high-fat diet Article Snippet: Primers were used to amplify two regions of the mouse Gal5.1 enhancer covering 8 CpGs: CpGs 4–8 (F–TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9–11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). .. Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the |